Laughter

 

Jessi: Ah, here's a resume from a philosophy major.

Jessi: Putting that degree to use right away, eh?

Chris: The Ballad of the Beleaguered Philosophy Major

Chris: Wanted: Philosophers. Degree required.

Chris: Must be able to comprehend and explain Truth

Jessi: I have deep, incoherent thoughts on all religions and political affiliations, but I'll also update your database on a weekly basis

Chris: Of course, one could make similar jokes about anyone who studied acting at college

Chris: I can portray any of Shakespeare's major characters. I'll be right back to take your drink orders.

Chris: Speaking of, if you were offered a regular, well-paying part in a show as stupid as "Mama's Family," would you take it?

Jessi: I don't know what to say...I think I might, just to get my foot in the t.v. door

Chris: Yes - it did wonders for Ken Barry's career

Chris: Hey! Let's take one of the funniest recurring characters on the Carol Burnett show, take out the title character, take out Carol Burnett, then build a show around the OTHER characters!

Chris: You know! The ones no body gave the slightest shit about!

Chris: Let's hear it!

Jessi: Adventures in [BOSSES' NAME OMITTED], part XII

Jessi: Before leaving for New York, John hands me two pieces of posterboard...filled, top to bottom with text and says...can you put this in Word and have it all fit on one page?

Jessi: POSTERBOARD

Chris: "Yes - I'll just bend all known rules of fonts and physics"

Jessi: Sure I'll fit it on one page - OF MICROFICHE

Chris: Do you ever just tell him no?

Jessi: Well, I said, "of course, you know the font will have to be tiny"

Jessi: and he said, "so what do you think?" and I said, "I think we should put it on however many pages are required to make it neat and legible"

Jessi: and he said, "ok, great"

Chris: Wow - what an amazing exchange

Chris: I honestly would not have thought to simply express an honest opinion

Jessi: So, in essence I always say no, but I make it sound like brainstorming

Jessi: "My screen froze, do you think I need a new machine?"

ME: Well, we could just try restarting that one.

Chris: HAHAHAH

Chris: ME: HAHAHAHAHAHAH

Chris: MARTIANS: AKKAKKAAKAKAKKAKAKAKKA

Chris: DNA: GATCATGATCTGATGATTAG!

Chris: TELETUBBIES: LALLALLALLALALALALALALALALA!

Jessi: WOOKIE: GUUUAAAAAAAAAAAAAAAAAAAAAAAAAAA

Jessi: R2D2: EBEBEBEBEBEBEBEBEBEBEBEEEEP

Chris: SHA NA NA: SHANANANANANANANANANNANANAANA!

Jessi: MONSTERS ON SESAME STREET: YIP YIP YIP YIP YIP YIP YIP

Chris: MY COMPUTER: 10100100101101010101010101110010101!

Jessi: FRAN DRESCHER: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Chris: RENE RUSSO: Ha.

Jessi: MIGHTY APRHODITE: HA

Jessi: STEVEN HAWKING: HA HA HA HA HA

Jessi: HAHAHAHAAAAA

Chris: MANCOW: What are you laughing at? Me? It must be me. GodDAMN, I'm great.

Jessi: Howard Stern: HEHEHEHEHAHAHAHAHAHAHA

Mancow: HEHEHEHHAHAHAHAHAHAHA

Jessi: !!!

Chris: !!!

Chris: It's uncanny the way we think alike. Scary, even.

Jessi: ANGRY CARTOONS: $$#%#%$%&$*#@$#&*(!$#$@%

Chris: AOL GEEKS: :) :) :) :) :) :) :) :) :) :) :)

Chris: MAN WHO DOESN'T REALIZE HIS CAPS LOCK KEY IS ON: wOW, THAT WAS PRETTY FUNNY! aLMOST AS FUNNY AS jIM cARREY!

Jessi: William Shatner: H.....A

Jessi: David Mamet: At this point....I must fucking come forth....and fucking say...ha

Jessi: Germans: JAJAJAJJAJJAJAJAJAJAJAJAJ

Russians: DAADAADADADADADADADADADAAAA

Chris: DAME JUDY DENCH: Ha ha!

THEATRE WORLD: Jesus, she's good.

Jessi: NBC: HAHAHAHAHA

 

NBC Two Weeks Later: HAHAHAHAHA

Chris: HAHAHHAHA

Jessi: CBS: I wish we could laugh like that.

Chris: CINEMAX: HAHAHAHAHAHAH naked people HAHAHAHAHAH

Jessi: Hindenburg Guy: OH MY GOD..THE HILARITY!

Chris: THE ONION: AMATEUR WEB WRITERS SPOOF LAUGHTER

"My favorite so far was the NBC one," says random reader

Jessi: "It's a perfect example of how brainstorming can lead to real creativity" says contributor

Chris: WOODY ALLEN: I'm not very attractive, and I'm insecure.

LOYAL, RABID FANS: HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!

Jessi: GEORGE LUCAS: HAHAHAHAH

 

FANS: I WAITED 16 YEARS TO HEAR THAT!

Chris: DREAMWORKS & DISNEY AT THE EXACT SAME TIME: HAHAHAHAHAHAhahaHAHAHHAhahaHAHAH

Jessi: KEVIN COSTNER: HAHAHAHHAHAHAHAHAHAHAHHAHAHAHAHAHAHAHAHAHHAHAHAHAHAHAHAHAHAHAHAHHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHHAAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAA

Chris: HAHAH!

Chris: PAMELA ANDERSON LEE: Hahahahahahahahahahahahahaha - SMACK

TOMMY LEE: SHut up, bitch.

Jessi: Jeff Goldblum: Uh...I...um...well...ha...I guess...haha, you know?

Jessi: Random Citizen: HAHAHAHAHAHAHHAHAAHHAAA

Chicago Cop: EAT HOT LEAD, ASSHOLE

Chris: SOMEONE WHO STILL THINKS HAIKUS ARE CLEVER:

Ha ha ha ha ha

Ha ha ha ha ha ha ha

Ha ha ha ha ha

Chris: JESUS: HAHAHAHAHAHAHAHAHAHAH

Jessi: HAHAHHAHAHAHAHHAHAAAAA

Jessi: [BOSSES' NAME OMITTED]: Jessica, can you laugh for me?

Chris: RELIGION: Jesus said "HAHAHAHAHAHAHAHAHAH"

BAPTISTS: No, you're not quoting it right. You'll go to hell for that, sinner.

Jessi: BAPTISTS: And you shouldn't be laughing anyway

Chris: JACK HELBIG OF READER FAME: This isn't funny, and furthermore it's the Death of American Laughter

Jessi: Darth Maul:

Chris: HAHAHAHA

Jessi: Yoda: ahahahah

Chris: !!!

Chris: I was just about to send that

Jessi: !!

Jessi: THE MEDIA: How did you feel when you realized that was funny?

Chris: RANDOM VICTIM: I never thought the laughter could happen here.

Jessi: THE GOVERMENT: NO MORE FUNNY CDS, GALLAGHER IS BAD FOR OUR CHILDREN

Chris: THE FRENCH: Le HAHAHAHAHAHAHAHHAHAHA. Stupid Americans.

Chris: CLINTON: HAHAHAHAHAHAHAH

THE REPUBLICANS: This joke is not funny because you laughed at it.

Jessi: JAY LENO: CLINTON RECEIVED ORAL SEX FROM MONICA LEWINSKY! HAHAHAHHAHAHAHAHAA

Chris: DAVID LETTERMAN, WITH SLIGHTLY DIFFERENT EMPHASIS AND INFLECTION: CLINTON RECEIVED ORAL SEX FROM MONICA LEWINSKY! HAHAHAHHAHAHAHAHAA

Chris: MICROSOFT: HAHAHAHAHAHAHAHAhaAHAHAH Time to upgrade to Laugh 2.0!

Jessi: APPLE: AHAHAHAHAHAHHAAah...sorry, a system error occured

Chris: APPLE: We blame Bill Gates for this.

Jessi: NETSCAPE: AHAHAHAHHAHAHA...EVERYONE...LAUGH LIKE THIS! HAHAHAHAHAAAA

Chris: CHICAGO'S NBC AFFILIATE: Tonight on E.R., they laughed like this: "HAHAHAHAHAHAHAHAH"

Jessi: STEVE DAHL: HAHAHA HAHAHAH

Chris: HAHAHAHAHAHHAHAHAHA

Chris: R.E.M.: HAHAHAHAHAHAHahahHAHA

FANS FROM WAY BACK: You fucking sell-outs.

Jessi: U2: HAHAHAHAHHAHAHAHAHAHHA

FANS FROM WAY BACK: You fucking sell-outs.

Chris: GARY OLDMAN: HAHAHAHAHAHAHAHAHAH!

Jessi: MAD MAGAZINE: THE LIGHTER SIDE OF...LAUGHTER

Chris: MAXIM MAGAZINE: In order to make a woman your sex slave for life, laugh like this: HAHAHAHAH

Jessi: DETAILS: In order to make a woman your sex slave for life...read 49 pages of ADS

Jessi: COSMO: 7 Ways To Laugh Yourself To Orgasm

Chris: THE LAST PAGE OF MAD MAGAZINE: Fold these two pages together for a special image!

HAHAHAHlots of meaningless stuff in hereHAHAHAHA

Jessi: HAHHAHAHAHAHAHHAHAHAHAHAAAA

Chris: ICE CUBE: HAHAHAHAHAHAHAHAHA, motha fucka.

Jessi: A Giraffe:

Chris: DADAIST: HAHAHAHAHAHAHAH This is not a laugh.

Jessi: Cubist: qqqqqqqqqqqqqqqqqqqqq

Chris: TELEMUNDO: AI! AI! AI! AI! AI! AI! AI! AI! AI! AI! AI! AI! AI! AI!

Jessi: Kerrie Strug: HAHAHAHHA *ow* HAHAHAAA

Chris: CRAIG KILBOURNE: Let's take a moment for us. HAHAHAHAHAHAHAhaha. Now let's go back over here.

Jessi: CHRIS FARLEY: "HAHAHAHA"

Chris: HAHAH!

Chris: JERRY SEINFELD: Do you ever notice the fake way people laugh in Instant Messages?

Jessi: OPRAH: HAHAHAHAHAHA

HOUSEWIVES OF THE WORLD: HAHAHAHAHAHA

Chris: HHAHAH

Jessi: Jerry Springer: HAHAHAHAHAHA

OPRAH: That's sick

Chris: BOB SAGET: HAHAHAHAHAHHAA

NETWORK: That's so funny, let's put it on TWO shows.

Jessi: NPR: HAHAHAHAHAHHAA, but a little more pretentious

Chris: FOX NETWORK: When people fall down at their own weddings, we go HAHAHAHAHAHAHAHAH!

Chris: FOX NETWORK: It makes us go HAHAHAHAHAHHAA to see a kid nail his father in the groin with a wiffle bat!

Jessi: FOX NETWORK: WHEN REAL PEOPLE LAUGH

Jessi: WB: WASSSUP? HAHAHAHHAAA

Jessi: UPN: Hahaahahahahaaa *crickets* hello?

Chris: DAVID LYNCH: HAHAHAHAHAHAHAHAHAHAH a dead fish. HAHAHAHAHAHAHAHAHAHAHA Dennis Hopper breathing into a mask. HAHAHAHAHAHHAAHAHAHA twelve.

Jessi: Channel 19: Laughing Getz Me Hi

 

 

HOME

 

  2000 Absurd Pamphlet Press